Protocols

Display Protocols
<< previous | 1 | 2 | 3 | 4
NameDescriptionLabTypeText
Add
Edit
Delete
aCat SUMO LS PurificationLarge Scale SUMOlayted aCat purification protocolAECOMpurificationBatch Ni Q Cleaved Batch Ni GF
Add
Edit
Delete
AECOM_default_cloningAECOM_default_cloningAECOMcloningLigation Independent Cloning Protocol NYSGRC Vector PCR Protocol The C-term vector amplification primer sequences are: Forward AACCTCTACTTCCAATCGCACCATCATCACCACCATTG Reverse TATATCTCCTTCTTA ...
Add
Edit
Delete
AECOM_default_crystal_harvestAECOM default protocol for harvesting crystals for diffractionAECOMcrystal harvestXXX
Add
Edit
Delete
AECOM_default_crystal_harvestingAECOM_default_crystal_harvestingAECOMcrystal harvestAECOM_default_crystal_harvesting
Add
Edit
Delete
AECOM_default_crystallizationAECOM default crystallization methodAECOMcrystallizationXXX
Add
Edit
Delete
AECOM_default_expressionAECOM_default_expressionexpressionStandard
Add
Edit
Delete
AG-HisTrapHis-tag purificationTAMUpurificationCells resuspended in 20 mM Hepes with 20 mM imidazole and 120 mM ammonium sulfate. Sonicated with PMSF and DNase. Eluted from Ni-affinity column with gradient of imidazole in buffer containing 500 mM ...
Add
Edit
Delete
HOBBS Gel filtration / anion exchangeClone tagless protein, precipitate with ammonium sulfate and purify using gel filtration and anion exchangeTAMUpurificationLarge scale purification with Gel Filtration followed by anion exchange Gel filtration buffer 50 mM HEPES pH 7.5 Anion Exchange Binding buffer 50mM HEPES pH 7.5 Anion Exchange Elution buffe ...
Add
Edit
Delete
Hobbs_HisTrapNi affinity chromatographyTAMUpurificationLarge scale purification with HisTrap 5mL column Binding Buffer 25mM Hepes pH7.5 40mM imidazole 500mM NaCl Elution Buffer 25mM Hepes pH 7.5 500mM imidazole 500mM NaCl 3 5mL overn ...
Add
Edit
Delete
Hobbs_ mutagenesisquick changeTAMUcloningQuick Change PCR protocol 50 ng template plasmid 125ng forward primer 125ng reverse primer 1 uL of dNTP mix 5% DMSO H2O to 50uL DPN1 Digest Parent DNA was digested by adding 1 ...
<< previous | 1 | 2 | 3 | 4