Clone

Target
APC100041  
Clone Suffix
102  
Sequence Comments
 
Local Protein Target ID
KzcdbeM9fTcAqwkVT9pvu1d97SE  
Local Clone Plate ID
TR000127  
Local Clone ID
1510000  
Experiment Start Date
Jul 14, 2010  
Experiment End Date
Jul 16, 2010  
Person
Shonda Clancy  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG7  
Sequence Start
1  
Sequence End
460  
Reference Sequence Used
MRTICLYFEI HQIIHLKRYR FFDIGTDHYY YDDYANETGM NEVAERSYIP ALSTLIEMVK NSGGAFKVAL SISGVALEQL EIHAPAVIDL LHQLNDTGCC EFLCEPYSHG LSSLANEDCF REEVLRQRDK MKQMFGKEPK VFRNSSLIYS DEIGGLVASM GFKGMLTEGA KHVLGWKSPH YVYHCNQAPS LKLLLRDFKL SDDIGLRFSN SEWPEYPLFA DKYINWIDAL PQEEQVINIF MELSALGMAQ PLSSNILEFL KALPECAKSK GITFSTPTEI VSKLKSVSQL DVPYPMSWVD EERDTSSWLG NILQREAFNK LYSVAERVHL CDDRRIKQDW DYLQASNNFR FMTTKNTGIW LNRGIYDSPY DAFTNYMNIL GDFIKRVDSL YPVDVDNEEL NSLLTTIKNQ GEEIAELQKE VTKWQAKAEK GAVKAPKKVA AKKEPVAKAT RKKATAKKEE  
Reference Sequence Variance
 
Confirmed Protein Sequence
 
PCR Forward Primer
TACTTCCAATCCAATGCCATGAGAACGATCTGTCTTTATTTCGAAATACATC  
PCR Backward Primer
TTATCCACTTCCAATGTTATTATTCTTCTTTCTTTGCAGTAGCTTTCTTACGA  
Shipped To Lab ID
ANL  
Shipped Date
2010-07-16  

Related Expressions

  Expression
Suffix
Experiment
Date
Start
Experiment
Date
End
Person Lab Protocol Status Expression
Organism
Media
Type
Induction
Reagent
Experiment
Type