Clone

Target
APC100030  
Clone Suffix
103  
Sequence Comments
 
Local Protein Target ID
Y4jCeatUWNuOBO7vvYy1+wwmN3E  
Local Clone Plate ID
TR002954  
Local Clone ID
24228000  
Experiment Start Date
Dec 02, 2013  
Experiment End Date
Dec 03, 2013  
Person
Shonda Clancy  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG73  
Sequence Start
18  
Sequence End
282  
Reference Sequence Used
FKSPITGRTY HLVFNDEFDD GVIDTLKWDT RSRRSPFTRR GMYQEKPYYV LCHEDWTKEL HGELRLEVSK YPTQNNVVMT GGILSLGRFM ARYGYYETKA SFRDCIGEGY WPAFWIHFDE ADKYGKGTEI DVFEYIPKDK QIFQTLHWYK KQAMEEQQSE VQHAALDYDK SGQFKEHRSS TKYFVLDEAQ SKEHTFAVEW TPEELIFYTD GKVTRRVNRK DDPKQVPSAY QMVYFSCSAG EWGGNVMENQ VPAYVYFDYC RCYQE  
Reference Sequence Variance
 
Confirmed Protein Sequence
 
PCR Forward Primer
TACTTCCAATCCAATGCCTTTAAATCGCCGATAACGGGTAGAACGT  
PCR Backward Primer
TTATCCACTTCCAATGTTATTCCTGATAACATCTGCAATAATCAAAATAGACATA  
Shipped To Lab ID
ANL  
Shipped Date
2013-12-03  

Related Expressions

  Expression
Suffix
Experiment
Date
Start
Experiment
Date
End
Person Lab Protocol Status Expression
Organism
Media
Type
Induction
Reagent
Experiment
Type